Journal: Biochimica et biophysica acta. Molecular basis of disease

Article Title: Integrated multiomic analysis identifies TRIP13 as a mediator of alveolar epithelial type II cell dysfunction in idiopathic pulmonary fibrosis

doi: 10.1016/j.bbadis.2024.167572

Figure Lengend Snippet: Key resources.

Article Snippet: Mouse IgG1 anti-human CD326 (EpCAM)-conjugated microbeads , Miltenyi Biotec , Cat# 130–061–101 RRID: AB_2832928.

Techniques: Plasmid Preparation, Magnetic Beads, Recombinant, Blocking Assay, Lysis, Protease Inhibitor, Red Blood Cell Lysis, Software, Microscopy, Fluorescence, Imaging

Journal: Biomolecules & Therapeutics

Article Title: Late Passage Cultivation Induces Aged Astrocyte Phenotypes in Rat Primary Cultured Cells

doi: 10.4062/biomolther.2020.175

Figure Lengend Snippet: Late passage astrocytes show reduced mitochondrial membrane potential and ATP production. (A) Astrocytes were conducted for mitochondrial membrane potential by fluorescence staining of TMRM. Representative images were obtained by the IncuCyte ZOOM microscope software 2015A (Essen Bioscience). The data were measured by IncuCyte software (Essen Bioscience). The representative graph shows the total TMRM object integrated intensity (RCU x μm 2 /image) and the total TMRM object area (μm 2 /image). Bars represent the mean ± SEM (n=3). **indicates p <0.01, and ***indicates p <0.001 vs. vehicle group. (B) The mitochondrial OCR of astrocytes was experimented using Cell Mito Test Kit and Agilent Seahorse XFe96 Analyzer (Agilent Technologies). The representative graphs were visualized using Wave Desktop 2.6 software (Agilent Technologies). The graphs represent the basal level, spare respiratory capacity, proton leak, and ATP production level. OCRs are mean ± SEM (n=3), normalized to the third measurement point and expressed as % baseline OCR. *indicates p <0.05 and, ***indicates p <0.001 vs. P1 astrocytes.

Article Snippet: We detected the red fluorescence using the IncuCyte ZOOM system (Essen Bioscience) by imaging each well every 30 min for 12 h and analyzed the red particles using the IncuCyte ZOOM microscope software 2015A (Essen Bioscience).

Techniques: Membrane, Fluorescence, Staining, Microscopy, Software

Journal: eLife

Article Title: Notch-induced endoplasmic reticulum-associated degradation governs mouse thymocyte β−selection

doi: 10.7554/eLife.69975

Figure Lengend Snippet: ( A ) Diagram showing two ER quality control machineries: ERAD and UPR. The E3 ubiquitin ligase HRD1 and its adaptor protein SEL1L is the most conserved ERAD complex in mammals. While correctly folded proteins exit the ER, misfolded proteins in the ER are recruited to the SEL1L-HRD1 complex through ER chaperones (such as BiP, EDEM, and OS9), and then retrotranslocated into the cytosol, ubiquitinated and degraded by the proteasome. Failure to clear the misfolded or unfolded proteins in the ER activates the UPR signaling through three ER stress sensors IRE1α, ATF6, and PERK. Upon activation, IRE1α oligomerizes and undergoes trans -autophosphorylation to activate its RNase domain, resulting in the removal of 26 nucleotides from unspliced XBP1 ( XBP1u ) mRNA to produce mature, spliced XBP1 ( XBP1s ) mRNA. PERK is a serine-threonine kinase. ER stress induces PERK-dependent eIF2α phosphorylation and subsequent increased cap-independent translation of ATF4 and induction of CHOP. ( B ) Schematic diagram of T-cell development in the thymus. CLP: common lymphoid progenitors; ETP: early T lineage precursor (Lin - CD4 - CD8 - CD44 + CD25 - CD117 + ); DN2: double negative two thymocytes (Lin - CD4 - CD8 - CD44 + CD25 + ); DN3: double negative three thymocytes (Lin - CD4 - CD8 - CD44 - CD25 + ); DN4: double negative four thymocytes (Lin - CD4 - CD8 - CD44 - CD25 - ); ISP: immature single-positive thymocytes (Lin - CD8 + CD24 + TCRβ - ); DP: double positive thymocytes (Lin - CD4 + CD8 + ); SP4: CD4 single positive thymocytes (Lin - CD4 + CD8 - ); SP8: CD8 single positive thymocytes (Lin - CD4 - CD8 + ). ( C ) Representative pseudocolor plots showing the gating strategy to identify different thymocyte subsets in the thymus.

Article Snippet: Other , CD4 (L3T4) MicroBeads, mouse 1 x 2 mL , 130-117-043 , Miltenyi Biotec , .

Techniques: Control, Ubiquitin Proteomics, Activation Assay, Phospho-proteomics

Journal: eLife

Article Title: Notch-induced endoplasmic reticulum-associated degradation governs mouse thymocyte β−selection

doi: 10.7554/eLife.69975

Figure Lengend Snippet: ( A ) Schematic of labeling and detection of nascent protein with OP-Puro. OP-Puro (O-propargyl puromycin) is a cell-permeable puromycin analog that is incorporated into the C-terminus of newly synthesized peptide chain. Fluorophore conjugated with Alexa Fluor 647 was then attached to OP-Puro through a copper-catalyzed click chemistry reaction between alkyne and azide group, which quantifies protein synthesis by fluorescence intensity. ( B ) Representative histogram (left) and quantification (right) of OP-Puro incorporation in different thymocyte subsets from 8-week-old wild-type mice. FMO represents AF647 control which is the background from the click chemistry in the absence of OP-Puro. MFI, mean fluorescence intensity. n = four mice. ( C ) Quantification of tetraphenylethene maleimide (TMI) fluorescence in different thymocyte subsets from 8-week-old wild-type mice. n = seven mice. ( D ) Quantitative RT-PCR analysis of ERAD ( Sel1l ) and UPR-related ( Xbp1 , Hspa5(Bip) , Dnajb9 , Ddit3 ( Chop ), Atf4 ) genes expression in different thymocyte subsets from 6-week-old wild-type mice. Data are presented relative to Actb; n = three mice. ( B–D ), ETP: early T lineage precursor (Lin - CD4 - CD8 - CD44 + CD25 - CD117 + ); DN2: double negative two thymocytes (Lin - CD4 - CD8 - CD44 + CD25 + ); DN3: double negative three thymocytes (Lin - CD4 - CD8 - CD44 - CD25 + ); DN4: double negative four thymocytes (Lin - CD4 - CD8 - CD44 - CD25 - ); DP: double positive thymocytes (Lin - CD4 + CD8 + ); SP4: CD4 single positive thymocytes (Lin - CD4 + CD8 - ); SP8: CD8 single positive thymocytes (Lin - CD4 - CD8 + ). Results are shown as mean ± s.d. The statistical significance was calculated by one-way ANOVA with Bonferroni test. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, n.s., not significant. Figure 1—source data 1. Excel file containing numerical values shown in .

Article Snippet: Other , CD4 (L3T4) MicroBeads, mouse 1 x 2 mL , 130-117-043 , Miltenyi Biotec , .

Techniques: Labeling, Synthesized, Fluorescence, Control, Quantitative RT-PCR, Expressing

Journal: eLife

Article Title: Notch-induced endoplasmic reticulum-associated degradation governs mouse thymocyte β−selection

doi: 10.7554/eLife.69975

Figure Lengend Snippet: ( A ) Representative flow cytometry plots of different thymocyte subsets in control (Ctrl, Sel1l flox/flox ) and Sel1l CKO ( Sel1l flox/flox ; CD2 -iCre) mice. ( B ) Diagram showing different stages of CD2 -iCre and Cd4-Cre initiated gene depletion during T cell development. ( C ) Quantitative RT-PCR analysis of Sel1l in different thymocyte subsets from control (Ctrl, Sel1l flox/flox ) and Sel1l flox/flox ; Cd4- Cre mice. Data are presented relative to Actb. n = 3. ( D and E ) Representative images of thymus ( D ) and quantification of thymus cellularity ( E ) in 6- to 8-week-old control (Ctrl, Sel1l flox/flox ) and Sel1l flox/flox ; Cd4- Cre mice. n = 3. ( F and G ) Quantification of cell numbers of different thymocyte subsets from control (Ctrl, Sel1l flox/flox ) and Sel1l flox/flox ; Cd4 -Cre mice. n = 3. ( H ) Percentage of Ctrl or Sel1l CKO donor-derived progenitors in the bone marrow of recipient mice 14 weeks after transplantation. n = 4–5. ( I ) Quantification of Ctrl or Sel1l CKO donor-derived DN3/DN4 ratio. n = 4–5. ( J ) Percentage of Ctrl or Sel1l CKO donor-derived CD4 + T cells, CD8 + T cells, myeloid cells, and dendritic cells (DC) in the spleen of recipient mice 14 weeks after transplantation. n = 4–5. ( K and L ) Cell cycle analysis of DN3 thymocytes in 6-week-old control (Ctrl) and Sel1l CKO mice using Ki67 and DAPI. Representative flow cytometry plots ( K ) and quantification ( L ) are shown. n = 3. Data are shown as mean ± s.d. The statistical significance was calculated by two-tailed unpaired t-test ( C, E-J ) or Two-way ANOVA with Bonferroni test ( L ). n.s., not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Figure 2—figure supplement 2—source data 1. Excel file containing numerical values shown in .

Article Snippet: Other , CD4 (L3T4) MicroBeads, mouse 1 x 2 mL , 130-117-043 , Miltenyi Biotec , .

Techniques: Flow Cytometry, Control, Quantitative RT-PCR, Derivative Assay, Transplantation Assay, Cell Cycle Assay, Two Tailed Test

Journal: eLife

Article Title: Notch-induced endoplasmic reticulum-associated degradation governs mouse thymocyte β−selection

doi: 10.7554/eLife.69975

Figure Lengend Snippet: ( A and B ) Representative images of thymus ( A ) and quantification of total thymocytes, DP, SP4 and SP8 thymocytes ( B ) from age (6-week-old) and gender-matched control (Ctrl, Sel1l flox/flox ), Sel1l KO ( Sel1l flox/flox ; CD2 -iCre), Perk KO ( Perk flox/flox ; CD2 -iCre)and Sel1l / Perk double knockout (DKO. Sel1l flox/flox , Perk flox/flox ; CD2 -iCre) mice. n = 3–5 each group. ( C and D ) Representative images of spleen ( C ) and quantification of total splenocytes, total CD3 + T cells, CD4 + T cells, and CD8 + T cells ( D ) from the same mice with indicated genotype as in A and B . n = 3–5 each group. ( E and F ) Representative images of the inguinal (left) lymph node ( E ) and quantification of total lymphocytes, total CD3 + T cells, CD4 + T cells, and CD8 + T cells ( F ) from the same mice with indicated genotype as in A and B . n = 3–5 each group. ( G ) Quantitative RT–PCR analysis of Chop expression in DN3 thymocytes sorted from mice with indicated genotype. n = 3–5 each group. ( H and I ) Representative images ( H ) and quantification ( I ) of cleaved caspase-3 (CC3)-positive cells in the thymus of 6- to 8-week-old gender-matched mice with indicated genotype. Twelve fields were counted at ×20 magnification from four mice with indicated genotype. Scale bars are indicated. Data are representative of three independent experiments and are shown as mean ± s.d. The statistical significance was calculated by two-tailed unpaired t-test ( D, F ) One-way ANOVA with turkey test ( B, G ) or one-way ANOVA with Bonferroni test ( I ). ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Figure 6—source data 1. Excel file containing numerical values shown in .

Article Snippet: Other , CD4 (L3T4) MicroBeads, mouse 1 x 2 mL , 130-117-043 , Miltenyi Biotec , .

Techniques: Control, Double Knockout, Quantitative RT-PCR, Expressing, Two Tailed Test

Journal: eLife

Article Title: Notch-induced endoplasmic reticulum-associated degradation governs mouse thymocyte β−selection

doi: 10.7554/eLife.69975

Figure Lengend Snippet:

Article Snippet: Other , CD4 (L3T4) MicroBeads, mouse 1 x 2 mL , 130-117-043 , Miltenyi Biotec , .

Techniques: Transgenic Assay, Sequencing, Mutagenesis, Recombinant, Reverse Transcription, SYBR Green Assay, In Situ, Staining, Live Cell Imaging, Synthesized, Software, Red Blood Cell Lysis

Journal: Cell Reports Medicine

Article Title: Development of allogeneic HSC-engineered iNKT cells for off-the-shelf cancer immunotherapy

doi: 10.1016/j.xcrm.2021.100449

Figure Lengend Snippet:

Article Snippet: Human CD14 MicroBeads Kit , Miltenyi Biotec , CAT#130-050-201.

Techniques: Enzyme-linked Immunosorbent Assay, Blocking Assay, Purification, Control, Virus, Recombinant, Cell Culture, Saline, Cell Isolation, RNA Sequencing, Gene Expression, Sequencing, Derivative Assay, Plasmid Preparation, Software, Imaging

Journal: Cell reports

Article Title: Directed differentiation of human iPSCs into mesenchymal lineages by optogenetic control of TGF-β signaling

doi: 10.1016/j.celrep.2023.112509

Figure Lengend Snippet: (A) optohiMSC morphology on standard tissue culture plastic and tdTomato-optoTGFBR expression. Scale bar, 200 μm. (B) Flow analysis for mesenchymal CD73, CD90, CD105, and lineage markers (CD45, CD34, CD14, CD79a, HLA-DR). Additional characterization displayed in and . (C) Plasma membrane localization of tdTomato-optoTGFBR2. Left: baseline, after 3 min of imaging without stimulation. Middle left: following a 1 s pulse of 488 nm confocal laser, response after 8 s; middle right: 16 s; right: 24 s. Scale bar, 20 μm. (D) Nuclear localization of iRFP682-tagged Smad2. Left: baseline, after 3 min of imaging without stimulation. Middle: following repeated cycles of 488 nm confocal laser stimulation (15 s) and imaging (30 s), response after 20 min; right: 40 min. Scale bar, 50 μm. (E) Mean intensity of nuclear iRFP682-Smad2 fluorescent signal within the dotted areas marked in (D). See also .

Article Snippet: CD90 MicroBeads, human , Miltenyi , Cat# 130-096-253.

Techniques: Expressing, Clinical Proteomics, Membrane, Imaging

Journal: Cell reports

Article Title: Directed differentiation of human iPSCs into mesenchymal lineages by optogenetic control of TGF-β signaling

doi: 10.1016/j.celrep.2023.112509

Figure Lengend Snippet: (A) Co-cultures of CD90-sorted non-optogenetic and optogenetic hiMSCs were maintained in shared smooth muscle induction medium and stimulated with either 10 ng/mL TGF-β3 (+T) or 3 μW 488 nm light with 5 min pulses every 2 h (+L3) for 2 weeks total. (B) Bright-field image with fluorescence overlay showing non-optogenetic (tdTomato−) and optogenetic (tdTomato+) hiMSCs prior to smooth muscle induction and TGF-β stimulation. Scale bar, 200 μm. (C) Flow cytometry analysis for calponin expression in non-optogenetic hiMSC population. (D) Flow cytometry analysis for calponin expression in optogenetic hiMSC population. All data represent means ± SD (n = 3). **p < 0.01, ****p < 0.0001 as calculated by one-way ANOVA and post hoc Tukey-Kramer’s multiple comparisons test.

Article Snippet: CD90 MicroBeads, human , Miltenyi , Cat# 130-096-253.

Techniques: Fluorescence, Flow Cytometry, Expressing

Journal: Cell reports

Article Title: Directed differentiation of human iPSCs into mesenchymal lineages by optogenetic control of TGF-β signaling

doi: 10.1016/j.celrep.2023.112509

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: CD90 MicroBeads, human , Miltenyi , Cat# 130-096-253.

Techniques: Affinity Purification, Virus, Recombinant, Protease Inhibitor, SYBR Green Assay, Solvent, Plasmid Preparation, Control, Functional Assay, Bicinchoninic Acid Protein Assay, Reverse Transcription, Quantitative Proteomics, Software

Journal: EMBO Reports

Article Title: Functional BRI2-TREM2 interactions in microglia: implications for Alzheimer’s and related dementias

doi: 10.1038/s44319-024-00077-x

Figure Lengend Snippet: Reagents and tools.

Article Snippet: Annexin V magnetic microbeads , Miltenyi , 130-090-201.

Techniques: Recombinant, Enzyme-linked Immunosorbent Assay, Sequencing, Gene Expression, Blocking Assay, Western Blot, Isolation, Biomarker Discovery, Software, Imaging, Real-time Polymerase Chain Reaction

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 1. MLH1 Deficiency Activates Innate Immune Signaling Pathway (A) Detection of cytosolic DNA in WT, Mlh1/ 4T1, and Mlh1-rescued (Rescd) 4T1 cells treated with or without IR, as indicated. DNA was detected using the PicoGreen fluorescence dye selectively binding dsDNA. Arrows point to cytosolic DNA. The scale bars are 10 mm. (B) Percentage of cells displaying cytosolic DNA with and without IR treatment. (C) Western blot analysis showing prolonged gH2AX in Mlh1/, but not in WT and Mlh1-rescued 4T1 cells after IR treatment. (D) Quantification of relative gH2AX levels in various 4T1 cells. (E) Increased production of cGAMP in Mlh1/ 4T1 cells. (F) Western blots showing enhanced phosphorylation of STING (pSTING) and STAT1 (pSTAT1) induced by IR in Mlh1/ cells. (G and H) Quantification of relative levels of pSTING (G) and pSTAT1 (H). (I) qRT-PCR analysis showing increased production of Isg15 in Mlh1/ cells. (J and K) Western blots (J) and qRT-PCR (K) showing that immune signaling induced by MLH1 deficiency depends on cGAS. When present, ‘‘’’ indicates untreated cells. Data represent the mean ± SEM of three independent experiments (B, D, G, and H) or three replicates (E, I, and K). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001. See also Figure S1.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Binding Assay, Western Blot, Phospho-proteomics, Quantitative RT-PCR

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 2. Exo1 is Essential for Innate Sensing Signaling in Mlh1–/– 4T1 Cells (A) Depletion of Exo1 reduces cytosolic DNA accumulation in Mlh1/ cells regardless of IR treatment. (B) Western blots showing reduced DNA breaks and pSTAT1 when Exo1 was depleted from Mlh1/ cells. A non-specific band detected by an Exo1 antibody is indicated by an asterisk. (C) Quantification of the relative gH2AX levels in Mlh1 knockout and Mlh1-Exo1 double-knockout (Dbl KO) cells. (D) Western blots showing that Exo1 knockout abolishes IR-induced STING activation. (E) Quantification of relative pSTING levels in Mlh1- knockout and Mlh1-Exo1 Dbl KO cells. (F) qRT-PCR analysis showing that Exo1 depletion suppressed expression of Isg15. Data represent the mean ± SEM of three inde- pendent experiments (A, C, and E) or three repli- cates (F). p values were calculated using one-way ANOVA. ****p < 0.0001. See also Figure S2.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Western Blot, Knock-Out, Double Knockout, Activation Assay, Quantitative RT-PCR, Expressing

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 3. MutLa Regulates Exo1 Nuclease Activity (A) Diagram of major functional domains in Exo1. (B) Co-immunoprecipitation/western blot analysis of MutLa interactions with WT and mutant Exo1 (right) using purified proteins (left). (C) Southern blot analysis determining the impact of the MutLa–Exo1 interaction on mismatch-provoked excision in a purified MMR system. The excision products were digested with SspI and processed for Southern blot analysis, as described in STAR Methods. Schematic representation of the 50 G-T heteroduplex after SspI digestion is shown on the right side of the gel. Positions of the nick and mismatch (red asterisk) are 544 bp and 416 bp away, respectively, from the bottom SspI site. Red bar indicates the 32P-labeled oligonucleotide probe, which is complementary to the nicked strand near the bottom SspI site. Red bracket shows mismatch-provoked excision products terminated upon mismatch removal in reactions with WT Exo1 but not in those with Exo1-FF-AA. (D) In vitro end-resection assay to determine the impact of the MutLa-Exo1 interaction on Exo1-catalyzed resection using purified proteins and a linearized 2.7-kb pUC19 plasmid DNA. MutLa concentration was 1 pmol (lower) or 4 pmol (higher). (E) Percentage of end-resection product II shown in (D) in three independent assays. (F) In vitro end-resection assay to determine the role of RPA in Exo1-catalyzed resection. The MutLa concentrations used in titration were 1 pmol, 2 pmol and 4 pmol. (G) Principle of in vivo end-resection assay. (H) qPCR analysis determining the amount of ssDNA generated at a specific DBS site (AsiSI) in WT and MLH1/ U2OS cells. Data represent the mean ± SEM of three independent experiments (E) or three replicates (H). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Activity Assay, Functional Assay, Immunoprecipitation, Western Blot, Mutagenesis, Southern Blot, Labeling, In Vitro, Resection Assay, Plasmid Preparation, Concentration Assay, Titration, In Vivo, Generated

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 4. Exo1 Recruitment, Abundance, and Stability in MLH1–/– Cells (A) Live cell imaging showing real-time recruitment and retention dynamics of GFP-tagged Exo1 after laser microirradiation in WT and MLH1/ HeLa cells. The scale bars are 5 mm. (B) Quantification of GFP-tagged Exo1 levels from the indicated number of cells. (C) Western blots showing whole cell lysate (WCL) and chromatin-bound levels of Exo1 and phos- phorylated Exo1 (pExo1) in WT and MLH1/ HeLa cells. (D) Quantification of relative total Exo1 levels in WT and MLH1/ HeLa cells. (E) Western blots showing WCL levels of Exo1 in WT and MLH1/ U2OS cells. (F) RNA-sequencing data from the TCGA database showing significantly higher Exo1 expression in dMLH1 tumors than in MSS tumors. (G) Quantification of relative pExo1 levels in WCL (upper) and on chromatin (lower) in WT and MLH1/ HeLa cells. Data represent the mean ± SEM of three inde- pendent experiments. p values were calculated using one-way ANOVA. ****p < 0.0001. See also Figure S3.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Live Cell Imaging, Western Blot, RNA Sequencing, Expressing

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 5. RPA Exhaustion and Aberrant Resection Intermediates in MLH1–/– Cells (A) Microscope imaging showing BrdU incorporation by DNA polymerase using hype-resection-generated unprotected RPA as a template for DNA synthesis in the RPA exhaustion assay. ssDNA binding by phosphorylated RPA (pRPA) is also shown. (B and C) Quantification of BrdU foci/cell (B) and percentage of cells exhibiting BrdU foci (C) in WT and MLH1/ U2OS cells. (D) Quantification of pRPA foci per cell. (E) Western blots detecting pRPA and its association with DNA break marker gH2AX in the indicated cells before and after IR. (F) Quantification of relative pRPA levels shown in (E), with three independent assays. (G) Immunofluorescence confocal analysis showing large RPA foci in HeLa MLH1/ cells. (H) Quantification and comparison of the percentage of WT and MLH1/ cells displaying RPA foci. (I) Immunofluorescence confocal analysis showing large Rad51 foci in MLH1/ HeLa cells. (J) Quantification of RAD51 foci/nucleus in various HeLa cells, as indicated. (K) Immunofluorescence confocal analysis showing large Rad51 foci in HCT116 and MLH1-rescued HCT116 cells. Data represent the mean ± SEM of three independent experiments (C, F, and H) or the indicated number of cells (B, D, and J). p values were calculated using one- way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Microscopy, Imaging, BrdU Incorporation Assay, Generated, DNA Synthesis, Binding Assay, Western Blot, Marker, Comparison

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 6. Chromosomal Abnormalities in MLH1–/– Cells (A–D) Chromosomal spreading analysis to deter- mine metaphase chromosomal breaks and other aberrations in 4T1 cells (A and C) and Mlh1/ 4T1 cells (B and D) with (C and D) and without (A and B) IR treatment. Chromosome breaks are indicated by green arrows while unresolved chromosomes are indicated by blue arrows. (E) Percentage of WT and Mlh1/ 4T1 cells con- taining the indicated number of chromosome ab- normalities. (F and G) Average number of chromosomal ab- normalities in WT and Mlh1/ 4T1 (F) and HeLa (G) cells. (H) Average number of chromosomal abnormal- ities in HCT116 and MLH1-rescued HCT116 cells. ***p < 0.001; ****p < 0.0001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques:

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 7. Model for MLH1–/–-Mediated cGAS Activation and Immunotherapy MutLa (MLH1-PMS2) properly terminates Exo1- catalyzed end resection, which facilitates DSB repair by HR (left). However, depleting MLH1 de- prives cells of MutLa, allowing Exo1 to conduct uncontrolled excision. This hyper-resection gen- erates a large quantity of ssDNA that exhausts the RPA pool, leaving the ssDNA chain unprotected. The unprotected ssDNA can be digested or nicked by various nucleases in the nucleus, which leads to abnormal recombination intermediates and chro- mosome breaks. The latter can trigger cells to degrade a part or all of the damaged chromosome to release nuclear DNA into the cytoplasm, acti- vating the cGAS-STING pathway and the down- stream immune responses. Together with the large number of neoantigens generated from mutations caused by MLH1 deficiency, the immune signaling activated by Exo1 hyper-resection facilitates immunotherapy.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Activation Assay, Immunopeptidomics, Generated

Journal: Cell reports

Article Title: Capicua suppresses YAP1 to limit tumorigenesis and maintain drug sensitivity in human cancer

doi: 10.1016/j.celrep.2022.111443

Figure Lengend Snippet:

Article Snippet: Lenti-ORF clone of CIC (mGFP-tagged) human capicua homolog , Origene , Cat# 215209L2.

Techniques: Virus, Recombinant, Transfection, Western Blot, Plasmid Preparation, Purification, Mutagenesis, Chromatin Immunoprecipitation, Magnetic Beads, Reporter Assay, Luciferase, Promoter Assay, shRNA, Software, Imaging, Sequencing

Journal: bioRxiv

Article Title: The PRR14 heterochromatin tether encodes modular domains that mediate and regulate nuclear lamina targeting

doi: 10.1101/788356

Figure Lengend Snippet: (A) Representative confocal imaging of HeLa cells showing localization of H3K9me3-marked heterochromatin (cyan), GFP-tagged PRR14 and mCherry-Lamin A/C (red). (B) A schematic model of H3K9me3/HP1 heterochromatin tethering to the nuclear lamina via PRR14. (C) A schematic representation of the PRR14 modular domain organization. (D) Representative confocal images of live HeLa cells transfected with GFP-tagged PRR14 fragments, as indicated. The N-terminal fragment (1-135) shows localization to heterochromatin, C-terminal fragment (366-585) localizes in nucleoplasm, centrally-located (231-282) fragment identified as a minimal nuclear lamina binding domain (LBD). Scale bars: 5μm.

Article Snippet: A human PRR14 expression vector was obtained previously from OriGene Technologies, Inc., encoding a C-terminal fusion with TurboGFP (cat# RG208696).

Techniques: Imaging, Transfection, Binding Assay

Journal: bioRxiv

Article Title: The PRR14 heterochromatin tether encodes modular domains that mediate and regulate nuclear lamina targeting

doi: 10.1101/788356

Figure Lengend Snippet: A series of PRR14 C-terminal truncations were created by introducing stop codons into the N-terminal GFP-tagged PRR14 reading frame. The end points of the C-terminal truncations are indicated. Representative confocal images of live HeLa cells stably expressing wild type mRFP-PRR14 transfected with (A) GFP-tagged truncation mutants. (B) composite mutants with substitutions in the LAVVL sequence required for heterochromatin binding (LAVVLmut). Counterstained with Hoechst.

Article Snippet: A human PRR14 expression vector was obtained previously from OriGene Technologies, Inc., encoding a C-terminal fusion with TurboGFP (cat# RG208696).

Techniques: Stable Transfection, Expressing, Transfection, Sequencing, Binding Assay

Journal: bioRxiv

Article Title: The PRR14 heterochromatin tether encodes modular domains that mediate and regulate nuclear lamina targeting

doi: 10.1101/788356

Figure Lengend Snippet: Representative confocal images of HeLa cells transfected with indicated GFP-PRR14 constructs and differentially permeabilized with Triton X-100 (plasma and nuclear membrane) or digitonin (plasma membrane only) to distinguish localization at the inner and outer nuclear periphery. Stained for GFP (red), Lamin A/C (cyan) and DAPI (blue). Scale bars: 5μm.

Article Snippet: A human PRR14 expression vector was obtained previously from OriGene Technologies, Inc., encoding a C-terminal fusion with TurboGFP (cat# RG208696).

Techniques: Transfection, Construct, Staining

Journal: bioRxiv

Article Title: The PRR14 heterochromatin tether encodes modular domains that mediate and regulate nuclear lamina targeting

doi: 10.1101/788356

Figure Lengend Snippet: (A) PRR14 map depicting the minimal 231-282 LBD. (B) Protein sequence alignment of the human 231-282 PRR14 LBD with mouse, xenopus, and gecko identified conserved residues: charged (gray) and hydrophobic (orange). Amino acid sequence identity (*) and similarity (.) are indicted. (C) Representative confocal images of HeLa cells transfected with GFP-tagged PRR14 231-282 LBD containing the indicated amino acid substitutions. (D) Box plot demonstrating the proportion of indicated PRR14-GFP proteins at the nuclear lamina, calculated using Lamin A/C signal as a mask. Boxes: median, interquartiles range with Tukey whiskers (“+” mean value). n=20 cells per condition. Statistical analyses performed using one-way ANOVA test with Dunn’s multiple comparison; **** p<0.0001, ns: not significant. Scale bars: 5μm.

Article Snippet: A human PRR14 expression vector was obtained previously from OriGene Technologies, Inc., encoding a C-terminal fusion with TurboGFP (cat# RG208696).

Techniques: Sequencing, Transfection

Journal: bioRxiv

Article Title: The PRR14 heterochromatin tether encodes modular domains that mediate and regulate nuclear lamina targeting

doi: 10.1101/788356

Figure Lengend Snippet: (A) GFP-tagged, full length human and mouse PRR14 proteins localize to the nuclear lamina in mouse cells. Human PRR14 localizes to the nuclear lamina in Xenopus cells. (B) GFP-tagged human PRR14 231-282 LBD localizes to the nuclear lamina in xenopus cells. GFP-tagged putative Xenopus PRR14 (see ) 152-203 LBD localizes to the nuclear lamina in HeLa cells. (C) Manual alignment with no gaps of human and mouse, and putative xenopus and gecko LBDs. Amino acid identity (*) and similarity (.) are indicated. Conserved blocks chosen for analyses are indicated by shading. End points of relevant C-terminal deletions analyzed in are indicated. Green arrow indicates retention of nuclear lamina association and red arrows indicate loss of nuclear lamina localization. Deletion into the most conserved region of the human 231-282 LBD resulted in loss of nuclear lamina localization .

Article Snippet: A human PRR14 expression vector was obtained previously from OriGene Technologies, Inc., encoding a C-terminal fusion with TurboGFP (cat# RG208696).

Techniques:

Journal: bioRxiv

Article Title: The PRR14 heterochromatin tether encodes modular domains that mediate and regulate nuclear lamina targeting

doi: 10.1101/788356

Figure Lengend Snippet: (A) Map of human PRR14 depicting the 231-282 LBD, del231-282, and IFL to AAA substitution (x) in the conserved core sequence. (B) Representative confocal images of HeLa cells transfected with GFP-tagged constructs (green) depicted in Panel A, Lamin A/C (red), and counterstained with DAPI. (C) Box plot demonstrating the proportion of indicated PRR14-GFP proteins at the nuclear lamina, calculated using Lamin A/C signal as a mask. Boxes: median, interquartiles range with Tukey whiskers (“+” mean value). n=20 cells per condition. (D) Line signal intensity profiles of corresponding images in panel B indicated by dashed lines. Statistical analyses performed using one-way ANOVA test with Dunn’s multiple comparison; **** p<0.0001, ns: not significant. Scale bars: 5μm.

Article Snippet: A human PRR14 expression vector was obtained previously from OriGene Technologies, Inc., encoding a C-terminal fusion with TurboGFP (cat# RG208696).

Techniques: Sequencing, Transfection, Construct

Journal: bioRxiv

Article Title: The PRR14 heterochromatin tether encodes modular domains that mediate and regulate nuclear lamina targeting

doi: 10.1101/788356

Figure Lengend Snippet: (A) Representative confocal images of murine C2C12 cells transfected with indicated PRR14-GFP constructs similar to experiment shown on . The IFL-AAA and del231-282 constructs colocalization with chromocenters is observed. However, composite mutants incapable of HP1/heterochromatin binding (LAVVLmut) lack chromocenter localization and spread through nucleoplasm. Though, the composite mutants showed some localization to the nuclear periphery, suggesting residual nuclear lamina binding. (B) Representative confocal images of HeLa cells transfected with indicated IFL-AAA and composite IFL-AAA LAVVL-mutant, stained for H3K9me3. Colocalization of the IFL-AAA, but not the composite mutant protein with H3K9me3 heterochromatin is observed. Scale bars: 5μm.

Article Snippet: A human PRR14 expression vector was obtained previously from OriGene Technologies, Inc., encoding a C-terminal fusion with TurboGFP (cat# RG208696).

Techniques: Transfection, Construct, Binding Assay, Mutagenesis, Staining

Journal: bioRxiv

Article Title: The PRR14 heterochromatin tether encodes modular domains that mediate and regulate nuclear lamina targeting

doi: 10.1101/788356

Figure Lengend Snippet: (A) Map, and sequence conservation of region downstream of 231-282 LBD hypothesized to contribute to nuclear lamina binding. Sequence alignment of human and gecko PRR14 identified candidate functional motifs. Amino acid sequence identity (*) and similarity (•) are indicted. Conserved motifs are designated as A through D. (B) Representative confocal images of HeLa cells transfected with indicated N-GFP tagged PRR14 fragments. Independent from the 231-282 LBD, the 283-351 fragment was found to localize to the nuclear lamina as a second independent modular LBD domain. (C) Box plot demonstrating the proportion of indicated PRR14-GFP proteins from panel B at the nuclear lamina, calculated using Lamin A/C signal as a mask. Boxes: median, interquartiles range with Tukey whiskers (“+” mean value). n=20 cells per condition. (D) Representative confocal images of HeLa cells transfected with indicated N-GFP tagged PRR14 constructs: WT, 231-351 deletion and composite mutant with 231-351 deletion and substitutions in the LAVVL sequence (LAVVLmut) required for heterochromatin binding. Statistical analyses performed using one-way ANOVA test with Dunn’s multiple comparison; *** p<0.001, ns: not significant. Scale bars: 5μm.

Article Snippet: A human PRR14 expression vector was obtained previously from OriGene Technologies, Inc., encoding a C-terminal fusion with TurboGFP (cat# RG208696).

Techniques: Sequencing, Binding Assay, Functional Assay, Transfection, Construct, Mutagenesis

Journal: bioRxiv

Article Title: The PRR14 heterochromatin tether encodes modular domains that mediate and regulate nuclear lamina targeting

doi: 10.1101/788356

Figure Lengend Snippet: Representative confocal images of HeLa cells transfected with GFP-tagged gecko PRR14 320-371, 320-410, and 320-444 fragments (green), stained for Lamin A/C (red) and DAPI (blue). Scale bars: 5μm.

Article Snippet: A human PRR14 expression vector was obtained previously from OriGene Technologies, Inc., encoding a C-terminal fusion with TurboGFP (cat# RG208696).

Techniques: Transfection, Staining

Journal: bioRxiv

Article Title: The PRR14 heterochromatin tether encodes modular domains that mediate and regulate nuclear lamina targeting

doi: 10.1101/788356

Figure Lengend Snippet: (A) Map and sequence of the human PRR14 231-282 LBD highlighting in vivo serine/threonine CDK SP/TP phosphorylation sites at positions 242, 266, 270 and 277. Phosphomimetic (PM) and phosphoablation (PA) substitutions are shown. For phosphomimetic substitutions, the four S/T phosphorylation sites were collectively changed to glutamic acid. For phosphoablation, the SP/TP context at all four sites was disrupted using cancer-related mutations (Table 2) (B) Representative confocal images of HeLa cells express the GFP-tagged PRR14 LBD (231-282) phosphomimetic (PM) glutamic acid substitutions resulted in loss of nuclear lamina localization. (C) Box plot demonstrating the proportion of indicated PRR14-GFP proteins from panel B at the nuclear lamina, calculated using Lamin A/C signal as a mask. Boxes: median, interquartiles range with Tukey whiskers (“+” mean value). n=20 cells per condition. (D) Representative confocal images of C2C12 cells express phosphomimetic (PM) and phosphoablation (PA) GFP-tagged full length PRR14. PM substitutions resulted in loss of PRR14 nuclear lamina association, as seen with the 231-282 LBD. The PA substitutions appeared to result in stronger localization at the nuclear lamina. (E) Box plot demonstrating the proportion of indicated PRR14-GFP proteins from panel D at the nuclear lamina, calculated using Lamin B1 signal as a mask. Boxes: median, interquartiles range with Tukey whiskers (“+” mean value). n=20 cells per condition. (F) Line signal intensity profiles of corresponding images in panel D indicated by dashed lines. Statistical analyses performed using one-way ANOVA test with Dunn’s multiple comparison; *** p<0.001, ** p<0.01, * p<0.05, ns: not significant. Scale bars: 5μm.

Article Snippet: A human PRR14 expression vector was obtained previously from OriGene Technologies, Inc., encoding a C-terminal fusion with TurboGFP (cat# RG208696).

Techniques: Sequencing, In Vivo

Journal: bioRxiv

Article Title: The PRR14 heterochromatin tether encodes modular domains that mediate and regulate nuclear lamina targeting

doi: 10.1101/788356

Figure Lengend Snippet: HeLa cells were transfected with GFP-tagged Lamin A or GFP-tagged PRR14. A region of interest at the nuclear lamina was bleached and fluorescent recovery was monitored. (A) Representative confocal images of PRR14-GFP or LaminA/C-GFP after photobleaching and recovery. (B) Graph shows signal monitored over a 5 minute period for comparing PRR14 and Lamin A recovery times. X-axis shows time (s) prior to and after photobleaching. Lamin A was previously reported to have a recovery time of ca. one hour. PRR14 recovered completely within seconds, Data analyses using the EasyFrap software indicated a t1/2 of 6.4 seconds with an R-square value of .95.

Article Snippet: A human PRR14 expression vector was obtained previously from OriGene Technologies, Inc., encoding a C-terminal fusion with TurboGFP (cat# RG208696).

Techniques: Transfection, Software

Journal: bioRxiv

Article Title: The PRR14 heterochromatin tether encodes modular domains that mediate and regulate nuclear lamina targeting

doi: 10.1101/788356

Figure Lengend Snippet: (A) Maps extracted from Pfam comparing human and mouse PRR14 and PRR14L paralogs, and the Drosophila Tantalus protein, showing the relationship with the Tantalus domain. (B) Summary of mutations to test the role of the putative conserved PP2A B56alpha recognition motif L/F/MxxIxE in the Tantalus domain of human PRR14. On the left are shown residues (in bold) in the B56alpha heat repeat that are known to mediate recognition of the substrates encoding the L/F/MxxIxE motif . The Drosophila B56alpha ortholog (dB56-2) shows 100 percent identity with human B56alpha in this region, consistent with the detection of Drosophila Tantalus-Drosophila B56alpha interactions . On the right are shown residues (in bold) in the PRR14 Tantalus domain corresponding to the L/F/MxxIxE B56alpha recognition motif. Shown are positions mutated in B56alpha and PRR14 to test effects on interactions. Amino acid sequence identity (*) is indicted. (C) HeLa cells were cotransfected with human HA-tagged B56alpha and non-fused GFP, or GFP fused to the human PRR14 Tantalus domain. The GFP bait proteins (GFP only, GFP-Tantalus) were collected using anti-GFP beads and analyzed by western for interaction with HA-tagged B56alpha. GFP bait proteins were detected using anti-GFP antibodies and prey proteins were detected with anti-HA antibodies. As shown, GFP-Tantalus pulled down HA-B56alpha, while the control non-fused GFP did not. Amino acid substitutions of non-conserved PRR14 Tantalus residues N483 and K484 (see Panel B) had no effect, while substitution of E500 and E501 with alanine eliminated interaction as predicted . (D) Experimental design was as in Panel C. Substitution of PRR14 Tantalus F495 with alanine inhibited binding, while substitution with leucine increased binding as predicted . (E) Experimental design was as in Panel C. Amino acid substitutions were introduced into the HA-tagged B56alpha subunit that were predicted to have no effect (G216Q) or inhibit binding (R222E and R226E) to the GFP-Tantalus domain . Results were consistent with these predictions. (F) A schematic cartoon showing PP2A interaction with PRR14 Tantalus domain. (G) Representative confocal images of HeLa cells transfected with indicated Tantalus domain amino acid substitutions introduced into full length GFP-tagged human PRR14 (see panel B). (H) Box plot demonstrating the proportion of indicated PRR14-GFP proteins from panel F at the nuclear lamina, calculated using Lamin A/C signal as a mask. Boxes: median, interquartiles range with Tukey whiskers (“+” mean value). n=20 cells per condition. Statistical analyses performed using one-way ANOVA test with Dunn’s multiple comparison; **** p<0.0001, ns: not significant. Scale bars: 5μm.

Article Snippet: A human PRR14 expression vector was obtained previously from OriGene Technologies, Inc., encoding a C-terminal fusion with TurboGFP (cat# RG208696).

Techniques: Sequencing, Western Blot, Binding Assay, Transfection

Journal: bioRxiv

Article Title: The PRR14 heterochromatin tether encodes modular domains that mediate and regulate nuclear lamina targeting

doi: 10.1101/788356

Figure Lengend Snippet: Human and mouse PRR14 and PRR14L Tantalus domain sequences are shown, aligned to positions 145-174 of the 299 amino acid Drosophila Tantalus protein. The 145-174 Drosophila Tantalus region shown is only a subset of the 119-198 Drosophila Tantalus domain, as it was the only region showing significant homology. Human PRR14, PRR14L, and Drosophila Tantalus had been identified as PP2A interactors (see main text) implicating the conserved core sequences (shaded) in mediating PP2A binding. Subsequently, the L/F/MxxIxE motif was identified as a common recognition sequence for the B56alpha regulatory subunit of PP2A (see main text).

Article Snippet: A human PRR14 expression vector was obtained previously from OriGene Technologies, Inc., encoding a C-terminal fusion with TurboGFP (cat# RG208696).

Techniques: Binding Assay, Sequencing

Journal: bioRxiv

Article Title: The PRR14 heterochromatin tether encodes modular domains that mediate and regulate nuclear lamina targeting

doi: 10.1101/788356

Figure Lengend Snippet: PRR14 is found to be highly modular protein. Several short evolutionary conserved motifs play key roles in bivalent tethering between heterochromatin and the nuclear lamina, and involved in regulation of association with the nuclear lamina.

Article Snippet: A human PRR14 expression vector was obtained previously from OriGene Technologies, Inc., encoding a C-terminal fusion with TurboGFP (cat# RG208696).

Techniques:

Journal: Molecular cell

Article Title: Mitophagy Controls the Activities of Tumor Suppressor p53 to Regulate Hepatic Cancer Stem Cells

doi: 10.1016/j.molcel.2017.09.022

Figure Lengend Snippet: (a) HepG2 with or without various treatments for 24 hours and stable HepG2 cells that expressed a control shRNA (sh-Ctrl) or the Atg5 shRNA (sh-Atg5) were subjected to flow cytometry analysis for CD133+ cells. Results represent the mean ± SEM of three independent experiments. None, no treatment. (B) HepG2 cells with the treatments shown in (A) were lysed for immunoblot analysis. LC3-I, non-lipidated LC3; LC3-II, lipidated LC3. The β-actin protein was also analyzed to serve as the loading control. (C) Sphere-formation assay of CD133+ and CD133− HepG2 cells. The panels shown to the left are representative results of spheres formed by CD133+ and CD133− HepG2 cells with and without stable ATG5 knockdown. Scale bar=200 μm. The histogram shown to the right indicated the number of spheres larger than 100 μm in diameter when 500 CD133+ cells were seeded. The results represent the mean ± SEM of three independent experiments. (D) HepG2 cells with various treatments for 24 hours were incubated with MicroBeads (Miltenyi Biotec) for the isolation of CD133+ cells, which were then analyzed for their sphere-forming ability. 500 cells were seeded for the assay. Also see Figure S1.

Article Snippet: Sphere-formation assay The Human CD133 MicroBead Kit (Miltenyi Biotec) was used to isolate CD133 + cells from HepG2, Hep3B and Huh7 cells.

Techniques: Control, shRNA, Flow Cytometry, Western Blot, Tube Formation Assay, Knockdown, Incubation, Isolation

Journal: Molecular cell

Article Title: Mitophagy Controls the Activities of Tumor Suppressor p53 to Regulate Hepatic Cancer Stem Cells

doi: 10.1016/j.molcel.2017.09.022

Figure Lengend Snippet: (A) Hep3B and Huh7 cells with various treatments for 24 hours were subjected to flow cytometry analysis for CD133+ cells. (B) HepG2 and Huh7 cells were transfected with the p53-expressing plasmid for two days, treated with 3-MA or rapamycin for another 24 hours and then subjected to flow cytometry analysis for CD133+ cells. (C) HepG2 cells transfected with the control siRNA (si-Ctrl) or the p53 siRNA (si-p53) for two days or treated with PFTα or DMSO for one day were analyzed for their CD133+ cells by flow cytometry (top panel) or sphere-forming ability of their CD133+ cells (bottom panel). The results shown in (A), (B) and (C) represent the mean ± SEM of three independent experiments. (D) HepG2 cells treated with DMSO or PFTα for one day or with siRNA for two days were lysed for immunoblot analysis. (E) Stable HepG2 cells that expressed control shRNA (sh-Ctrl), sh-Atg5, or both sh-Atg5 and sh-p53 were lysed for immunoblot analysis. (F) Cells mentioned in (E) were used for the sphere-formation assay. Also see Figure S2.

Article Snippet: Sphere-formation assay The Human CD133 MicroBead Kit (Miltenyi Biotec) was used to isolate CD133 + cells from HepG2, Hep3B and Huh7 cells.

Techniques: Flow Cytometry, Transfection, Expressing, Plasmid Preparation, Control, Western Blot, shRNA, Tube Formation Assay

Journal: Molecular cell

Article Title: Mitophagy Controls the Activities of Tumor Suppressor p53 to Regulate Hepatic Cancer Stem Cells

doi: 10.1016/j.molcel.2017.09.022

Figure Lengend Snippet: (A) HepG2 cells with various treatments for 24 hours or stably expressing the control shRNA or the Atg5 shRNA were lysed for immunoblot analysis. (B) Immunoblot analysis of HepG2 cells transfected with either the control vector or the expression vector for various p53 proteins. Cells were lysed two days after DNA transfection for immunoblot analysis. None, control cells with no DNA transfection. (C) The experiments were conducted the same way as in (B), with the exception that Hep3B cells were used for the expression studies. (D) Hep3B or HepG2 cells were transfected with various p53-expressing plasmids or the control vector as indicated for two days followed by flow cytometry analysis for CD133+ cells. (E) HepG2 cells were transfected with the p53-expressing plasmids for two days, and CD133+ cells were then isolated for the sphere-formation assay. (F) The experiments were conducted the same way as in (E), with the exception that Hep3B cells were used for the studies. The results in (D–F) represented the mean ± SEM of three independent experiments. Also see Figure S3.

Article Snippet: Sphere-formation assay The Human CD133 MicroBead Kit (Miltenyi Biotec) was used to isolate CD133 + cells from HepG2, Hep3B and Huh7 cells.

Techniques: Stable Transfection, Expressing, Control, shRNA, Western Blot, Transfection, Plasmid Preparation, Flow Cytometry, Isolation, Tube Formation Assay

Journal: Molecular cell

Article Title: Mitophagy Controls the Activities of Tumor Suppressor p53 to Regulate Hepatic Cancer Stem Cells

doi: 10.1016/j.molcel.2017.09.022

Figure Lengend Snippet: (A) Top panel, HepG2 cells were treated with DMSO, Mdivi-1 or CCCP for one day and then subjected to flow cytometry analysis for CD133+ cells; bottom panel, CD133+ HepG2 cells were isolated and treated with Mdivi-1 or CCCP for two days and then analyzed for their sphere-forming ability. (B) HepG2 cells without treatment or with the treatment of DMSO, CCCP or Mdivi-1 for one day were lysed for immunoblot analysis. Cells were also subjected to subcellular fractionation for the isolation of mitochondria, cytosol, and nuclei for immunoblot analysis. Tom20, β-actin and lamin B1 were used as the loading controls for mitochondria, cytosol and nucleus, respectively, to ensure equal amount of proteins were loaded on the gel. (C) Confocal microscopy for the analysis of the subcellular localization of p53(pS392) in HepG2 cells treated with DMSO, Mdivi-1 or CCCP. TOM20 was used as the marker for mitochondria. The areas boxed are enlarged at the bottom. Scale bar, 10 μm. (D) The results shown in (C) were quantified with a Leica TCS SP8 fluorescent confocal microscope. The results indicated the percentages of p53(pS392) that colocalized with TOM20. The results represent the mean ± SEM of at least 30 cells that were analyzed. See also Figure S5.

Article Snippet: Sphere-formation assay The Human CD133 MicroBead Kit (Miltenyi Biotec) was used to isolate CD133 + cells from HepG2, Hep3B and Huh7 cells.

Techniques: Flow Cytometry, Isolation, Western Blot, Fractionation, Confocal Microscopy, Marker, Microscopy

Journal: Molecular cell

Article Title: Mitophagy Controls the Activities of Tumor Suppressor p53 to Regulate Hepatic Cancer Stem Cells

doi: 10.1016/j.molcel.2017.09.022

Figure Lengend Snippet: (A) Effects of PINK1 knockdown on CD133+ HepG2 cells (top panel), their sphere-forming ability (middle panel) and their effects on the Nanog promoter using the Nanog-luc1 reporter (bottom panel). HepG2 cells transfected with either the control siRNA or the PINK1 siRNA for two days were analyzed. In the bottom panel, HepG2 cells were also transfected with the Nanog-luc1 reporter (see Figure 3B) for the analysis of luciferase activity. The luciferase activity of cells without the transfection of siRNA was arbitrarily defined as 1. The results represented the mean ± SEM of three independent experiments. (B) Effects of PINK1 over-expression on CD133+ HepG2 cells (top panel), their sphere-forming ability (middle panel) and their effects on the Nanog promoter (bottom panel). The experiments were conducted the same way as in (A), except that instead of using siRNA, cells were transfected with either the control vector or the PINK1-expressing plasmid. (C) Immunoblot analysis of HepG2 cells with PINK1 knockdown (left panels) or PINK1 over-expression (right panels) were lysed for immunoblot analysis. Total cell lysates as well as the nuclear lysates (bottom two panels) were analyzed. (D) PINK1 in HepG2, Hep3B or Huh7 cells was immunoprecipitated with a control antibody (−) or the anti-PINK1 antibody (+) and then incubated with GST-p53 in the presence of ATP. The GST-p53 phosphorylated at S392 was analyzed using the anti-p53 antibody that recognized phosphoserine-392. GST-p53 added in the reaction and PINK1 immunoprecipitated were also analyzed by immunoblot (bottom two panels). Numbers to the left of the top panel indicate protein molecular weight markers. (E) GST-p53 was mixed with GST-PINK1 or GST and incubated in the presence of ATP. The phosphorylation of p53 at S392 was then analyzed with the antibody that recognized phosphoserine-392. GST-p53, GST-PINK1 and GST used for the reaction was also analyzed by anti-p53, anti-PINK1 and anti-GST antibodies, respectively (bottom three panels). Numbers to the left indicate protein molecular weight markers. (F) Co-immunoprecipitation of p53 and p53(pS392) with PINK1. HepG2 cells were lysed and immunoprecipitated using the anti-PINK1 antibody or the control antibody followed by immunoblot analysis for p53, p53(pS392) and PINK1. (G) Co-immunoprecipitation of p53 and p53(pS392) with PINK1 using the anti-PINK1 antibody in different subcellular fractions (top 3 panels). β-actin, lamin B1 and Tom20 were used as the markers for cytosolic (C), nuclear (N) and mitochondrial (M) fractions. Equal amounts of p53 were used for the co-immunoprecipitation experiment (bottom 2 panels). See also Figure S6.

Article Snippet: Sphere-formation assay The Human CD133 MicroBead Kit (Miltenyi Biotec) was used to isolate CD133 + cells from HepG2, Hep3B and Huh7 cells.

Techniques: Knockdown, Transfection, Control, Luciferase, Activity Assay, Over Expression, Plasmid Preparation, Expressing, Western Blot, Immunoprecipitation, Incubation, Molecular Weight, Phospho-proteomics

Journal: Molecular cell

Article Title: Mitophagy Controls the Activities of Tumor Suppressor p53 to Regulate Hepatic Cancer Stem Cells

doi: 10.1016/j.molcel.2017.09.022

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Sphere-formation assay The Human CD133 MicroBead Kit (Miltenyi Biotec) was used to isolate CD133 + cells from HepG2, Hep3B and Huh7 cells.

Techniques: Virus, Recombinant, Plasmid Preparation, Bicinchoninic Acid Protein Assay, Mouse Assay, Mutagenesis, Software, Imaging, Extraction, Isolation, DNA Labeling

Journal: Journal of Cell Science

Article Title: Myosin-Va restrains the trafficking of Na + /K + -ATPase-containing vesicles in alveolar epithelial cells

doi: 10.1242/jcs.046953

Figure Lengend Snippet: cAMP increases Na+/K+-ATPase activity, protein abundance at the plasma membrane and the distance traveled by the Na+/K+-ATPase-containing vesicles in A549-GFPα1 cells. (A) A549-GFPα1 cells were incubated in the absence (CT) or presence of 50 μM forskolin (FSK) for 10 minutes and the Na+/K+-ATPase activity was measured as 86Rb+ uptake. Graph represents mean ± s.e.m. of three experiments. (B) A549-GFPα1 cells were incubated as in A, and the Na+/K+-ATPase abundance at the basolateral plasma membrane was determined by western blot of the BLM fraction using a specific antibody against GFP. E-cadherin was used as a loading control. Graph represents mean ± s.e.m. of three experiments. A representative western blot is shown. (C) The movement of the GFP-labeled particles was recorded as Metamorph stacks and vesicle trajectories were obtained by single-particle tracking using Metamorph software. Vesicles were randomly selected from those that showed plus-end-directed displacement. Left panel shows a representative image of A549-GFPα1 cells. Arrowhead indicates the vesicle whose trajectory is shown in the right panel before (CT) and after FSK treatment (FSK). (D) Average contour length traveled by the vesicles as a function of time. The black line represents control vesicles; at 60 seconds, upon addition of FSK (red line), the vesicles move at a faster rate. The average contour length is determined by averaging over many trajectories as described in the Materials and Methods. **P<0.01; ***P<0.001. Scale bars: 10 μm and 2 μm (magnified images).

Article Snippet: Cell culture Human A549 (ATCC CCL 185) and HeLa cells (ATCC CCL 2) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 μg/ml streptomycin and 20 mM HEPES.

Techniques: Activity Assay, Incubation, Western Blot, Labeling, Single-particle Tracking, Software

Journal: Journal of Cell Science

Article Title: Myosin-Va restrains the trafficking of Na + /K + -ATPase-containing vesicles in alveolar epithelial cells

doi: 10.1242/jcs.046953

Figure Lengend Snippet: The three isoforms of myosin-V are expressed in A549 cells. (A) RT-PCR using mRNA obtained from A549 and HeLa cells. Primers used for the amplification are described in supplementary material Table S6. (B) Cell lysates from A549 and HeLa cells were obtained and analyzed by western blot with specific antibodies against the three myosin-V isoforms. A representative western blot is shown. (C) The particulate fraction (100,000 g pellet) of A549-GFPα1 cells was loaded onto a flotation sucrose gradient and eight fractions were recovered. The distribution of the proteins of interest was analyzed by western blotting with specific antibodies. A representative western blot is shown. Rab5 and Rab7 are used as markers of early and late endosomes, respectively. (D) Gradients obtained in C were scanned and the marker content was digitally quantified as indicated. Results are expressed as percentage of the total amount of protein.

Article Snippet: Cell culture Human A549 (ATCC CCL 185) and HeLa cells (ATCC CCL 2) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 μg/ml streptomycin and 20 mM HEPES.

Techniques: Reverse Transcription Polymerase Chain Reaction, Amplification, Western Blot, Marker

Journal: Journal of Cell Science

Article Title: Myosin-Va restrains the trafficking of Na + /K + -ATPase-containing vesicles in alveolar epithelial cells

doi: 10.1242/jcs.046953

Figure Lengend Snippet: Myosin-Va and myosin-Vc colocalize with Na+/K+-ATPase. (A) A549-GFPα1 cells were incubated in the absence or presence of 50 μM FSK for 10 minutes, basolateral membranes (BLM) and intracellular compartments (IC) were isolated and the Na+/K+-ATPase abundance was determined by western blot using a specific antibody against GFP. E-cadherin and actin were used as loading controls for the BLM and IC fractions, respectively. Graph represents mean ± s.e.m. of three experiments. A representative western blot is shown. (B) The IC fraction of A549-GFPα1 cells was loaded onto a flotation sucrose gradient and eight fractions were recovered. The distribution of the proteins of interest was analyzed by western blotting with specific antibodies. A representative western blot is shown. C+, positive control.

Article Snippet: Cell culture Human A549 (ATCC CCL 185) and HeLa cells (ATCC CCL 2) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 μg/ml streptomycin and 20 mM HEPES.

Techniques: Incubation, Isolation, Western Blot, Positive Control

Journal: Journal of Cell Science

Article Title: Myosin-Va restrains the trafficking of Na + /K + -ATPase-containing vesicles in alveolar epithelial cells

doi: 10.1242/jcs.046953

Figure Lengend Snippet: The average speed of Na+/K+-ATPase-containing vesicles moving towards the cell periphery is increased in cells expressing a myosin-Va stalk-tail. (A) Live imaging of A549-GFPα1 cells (green) transiently transfected with a dominant-negative myosin-Va that has a m-cherry-tag (red) (m-cherry-DN-Va). The movement of the GFP-labeled particles was recorded. Upper panels show a representative image of the transfected A549-GFPα1 cells. Lower panels show the tracking of the movement of one vesicle before (CT) and after forskolin treatment (FSK). (B) Average contour length traveled by the vesicles in A as a function of time. The black line represents the control vesicles; FSK was added at time 60 seconds and is represented as a red line. (C) Live imaging of A549-GFPα1 cells (green) transiently transfected with a dominant-negative myosin-Vc that has a m-cherry-tag (red) (m-cherry-DN-Vc). The movement of the GFP-labeled particles was recorded. Upper panels show a representative image of the transfected A549-GFPα1 cells. Lower panels show the tracking of the movement of one vesicle before (CT) and after forskolin treatment (FSK). (D) Average contour length traveled by the vesicles in C as a function of time. The black line represents control vesicles; FSK was added at 60 seconds and is represented as the red line. Scale bars: 10 μm and 2 μm (magnified images).

Article Snippet: Cell culture Human A549 (ATCC CCL 185) and HeLa cells (ATCC CCL 2) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 μg/ml streptomycin and 20 mM HEPES.

Techniques: Expressing, Imaging, Transfection, Dominant Negative Mutation, Labeling

Journal: Journal of Cell Science

Article Title: Myosin-Va restrains the trafficking of Na + /K + -ATPase-containing vesicles in alveolar epithelial cells

doi: 10.1242/jcs.046953

Figure Lengend Snippet: The average speed of Na+/K+-ATPase-containing vesicles moving towards the cell periphery is increased in cells expressing a shRNA against myosin-Va. (A) Live imaging of A549-GFPα1 cells (green) transiently transfected with a shRNA against myosin-Va that has a m-cherry-tag (red) (m-cherry-sh-Va). The movement of the GFP-labeled particles was recorded. Upper panels show a representative image of the transfected A549-GFPα1 cells. Lower panels show the tracking of the movement of two vesicles (arrowheads) under control (CT) conditions. (B) Live imaging of A549-GFPα1 cells (green) transiently transfected with a shRNA against myosin-Vc that has a m-cherry-tag (red) (m-cherry-shRNA-Vc). The movement of the GFP-labeled particles was recorded. Upper panels show a representative image of the transfected A549-GFPα1 cells. Lower panels show the tracking of the movement of two vesicles (arrowheads) under control (CT) conditions (C). Graph represents the average contour length traveled by the vesicles as a function of time, calculated as described in methods. The black line represents the m-cherry-sh-Va vesicles and the red line, the m-cherry-sh-Vc vesicles. (D) A549-GFPα1 cells were transfected with a shRNA against myosin-Va or myosin-Vc, cell lysates were isolated and the myosin-Va (left panel) or myosin-Vc (right panel) abundance was determined by western blot using specific antibodies. E-cadherin and tubulin were used as loading controls. Scale bars: 10 μm and 4 μm (magnified images).

Article Snippet: Cell culture Human A549 (ATCC CCL 185) and HeLa cells (ATCC CCL 2) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 μg/ml streptomycin and 20 mM HEPES.

Techniques: Expressing, shRNA, Imaging, Transfection, Labeling, Isolation, Western Blot

Journal: Journal of Cell Science

Article Title: Myosin-Va restrains the trafficking of Na + /K + -ATPase-containing vesicles in alveolar epithelial cells

doi: 10.1242/jcs.046953

Figure Lengend Snippet: Dominant-negative myosin-Va mimics cAMP-mediated Na+/K+-ATPase increased activity and recruitment to the plasma membrane in A549-GFPα1 cells. (A) Stable clones expressing myosin-Va tail (DN-Va) and myosin-Vc tail (DN-Vc) were generated as described. Expression of the constructs in the permanent clones was analyzed by western blotting using and antibody against the V5 tag. A representative western blot is shown. (B) A549-GFPα1 cells (CT) and A549-GFPα1 cells permanently transfected with DN-Va and DN-Vc were incubated in the absence or presence of 50 μM FSK for 10 minutes and the Na+/K+-ATPase activity was measured as 86Rb+ uptake. Graph represents mean ± s.e.m. of three different experiments. (C) Control (CT), DN-Va and DN-Vc cells were incubated in the absence or presence of 50 μM FSK for 10 minutes and western blots of the basolateral membrane fraction were performed using a specific antibody against GFP. E-cadherin was used as loading control. A representative western blot is shown. *P<0.05; **P<0.01; n.s., not significant; u.s., unstimulated.

Article Snippet: Cell culture Human A549 (ATCC CCL 185) and HeLa cells (ATCC CCL 2) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 μg/ml streptomycin and 20 mM HEPES.

Techniques: Dominant Negative Mutation, Activity Assay, Clone Assay, Expressing, Generated, Construct, Western Blot, Transfection, Incubation

Journal: Journal of Cell Science

Article Title: Myosin-Va restrains the trafficking of Na + /K + -ATPase-containing vesicles in alveolar epithelial cells

doi: 10.1242/jcs.046953

Figure Lengend Snippet: Myosin-Va and the Na+/K+-ATPase-containing vesicles colocalize. A549-GFPα1 cells were fixed, permeabilized and blocked. Myosin-Va was visualized by using an anti-myosin-Va antibody and a secondary antibody labeled with Alexa Fluor 568. GFP was directly visualized. Cellular distribution of Na+/K+-ATPase-GFPα1 and myosin-Va was analyzed using a Zeiss LSM 510 laser-scanning confocal microscope and colocalization (blue) was determined using the LSM 510 Meta software.

Article Snippet: Cell culture Human A549 (ATCC CCL 185) and HeLa cells (ATCC CCL 2) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 μg/ml streptomycin and 20 mM HEPES.

Techniques: Labeling, Microscopy, Software

Journal: Journal of Cell Science

Article Title: Myosin-Va restrains the trafficking of Na + /K + -ATPase-containing vesicles in alveolar epithelial cells

doi: 10.1242/jcs.046953

Figure Lengend Snippet: Microtubules and actin filaments are involved in Na+/K+-ATPase traffic. (A) Live imaging of A549 cells incubated with 10 μM nocodazole for 3 hours. The movement of the GFP-labeled particles was recorded as Metamorph stacks and vesicle trajectories were obtained by single-particle tracking using Metamorph software. Upper panels show a representative immunofluorescence of the microtubule cytoskeleton in control (left) and nocodazole (right) conditions. Lower panel shows the tracking of the movement of one vesicle in control (left) and nocodazole (right) conditions. (B) Live imaging of A549 cells incubated with 5 μM cytochalasin D (Cyto D) for 1 hour. The movement of the GFP-labeled particles was recorded as Metamorph stacks and vesicle trajectories were obtained by single-particle tracking using Metamorph software. Upper panels show a representative immunofluorescence of the actin cytoskeleton under control (left) and cytochalasin D (right) conditions. Lower panel shows the tracking of the movement of one vesicle in control (left) and cytochalasin D (right) conditions. (C) Average contour length traveled by the vesicles as a function of time. The blue line represents the control vesicles; the black line, cells treated with cytochalasin D and the red line, cells treated with nocodazole. Scale bars: 10 μm and 2 μm (inset images).

Article Snippet: Cell culture Human A549 (ATCC CCL 185) and HeLa cells (ATCC CCL 2) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 μg/ml streptomycin and 20 mM HEPES.

Techniques: Imaging, Incubation, Labeling, Single-particle Tracking, Software, Immunofluorescence